graph pad prism dotmatics version 10 incucyte sartorius version 2020 flowjo flowjo llc version 10 10 1 huygens compute engine scientific (Sartorius AG)
Sartorius AG is a verified supplier 
Sartorius AG manufactures this product 
99
Structured Review
Sartorius AG
graph pad prism dotmatics version 10 incucyte sartorius version 2020 flowjo flowjo llc version 10 10 1 huygens compute engine scientific
Graph Pad Prism Dotmatics Version 10 Incucyte Sartorius Version 2020 Flowjo Flowjo Llc Version 10 10 1 Huygens Compute Engine Scientific, supplied by Sartorius AG, used in various techniques. Bioz Stars score: 99/100, based on 16104 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/graph/Live+Cell+Analysis+Instruments/pm42800031-476-72-79
Average 99 stars, based on 16104 article reviews
Graph Pad Prism Dotmatics Version 10 Incucyte Sartorius Version 2020 Flowjo Flowjo Llc Version 10 10 1 Huygens Compute Engine Scientific, supplied by Sartorius AG, used in various techniques. Bioz Stars score: 99/100, based on 16104 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/graph/Live+Cell+Analysis+Instruments/pm42800031-476-72-79
Average 99 stars, based on 16104 article reviews
graph pad prism dotmatics version 10 incucyte sartorius version 2020 flowjo flowjo llc version 10 10 1 huygens compute engine scientific - by Bioz Stars,
2026-10
99/100 stars
Images
Related Articles
Negative Control:Article Title: Chikungunya virus uses the tetraspanins CD63, CD9, and CD151 to replicate in human synovial fibroblasts. Article Snippet: .. Oligonucleotides Silencer negative control no. 2 siRNA Thermo Fisher Scientific Cat# AM4613 Silencer GFP siRNA Thermo Fisher Scientific Cat# AM4626 CATCTGCACCCAAGTGTACCA microsynth qPCR CHIKV fw GCGCATTTTGCCTTCGTAATG microsynth qPCR CHIKV rev 6FAM-CggTgTACACTgCCTgTgACYgC—BBQ TIB MolBiol CHIKV probe Recombinant DNA pczVSV-G Hoffmann et al.43 https://doi.org/10.1099/vir.0.023978–0 pIRES2-eGFP CHIKV E3-E1 Salvador et al.44 https://doi.org/10.1016/j.virol.2009.07.013 pChik-LR-5‘GFP Tsetsarkin et al.40 https://doi.org/10.1089/vbz.2006.6.325 pChikRepl-eGFP Gläsker et al.45 https://doi.org/10.1186/1743-422X-10–23 pcDNA3.1(+) Addgene Cat# V790-20 Software and algorithms Fiji – ImageJ https://github.com/fiji/fiji Version 2.14.0/1.54f Real-time Polymerase Chain Reaction:Article Title: Chikungunya virus uses the tetraspanins CD63, CD9, and CD151 to replicate in human synovial fibroblasts. Article Snippet: .. Oligonucleotides Silencer negative control no. 2 siRNA Thermo Fisher Scientific Cat# AM4613 Silencer GFP siRNA Thermo Fisher Scientific Cat# AM4626 CATCTGCACCCAAGTGTACCA microsynth qPCR CHIKV fw GCGCATTTTGCCTTCGTAATG microsynth qPCR CHIKV rev 6FAM-CggTgTACACTgCCTgTgACYgC—BBQ TIB MolBiol CHIKV probe Recombinant DNA pczVSV-G Hoffmann et al.43 https://doi.org/10.1099/vir.0.023978–0 pIRES2-eGFP CHIKV E3-E1 Salvador et al.44 https://doi.org/10.1016/j.virol.2009.07.013 pChik-LR-5‘GFP Tsetsarkin et al.40 https://doi.org/10.1089/vbz.2006.6.325 pChikRepl-eGFP Gläsker et al.45 https://doi.org/10.1186/1743-422X-10–23 pcDNA3.1(+) Addgene Cat# V790-20 Software and algorithms Fiji – ImageJ https://github.com/fiji/fiji Version 2.14.0/1.54f Recombinant:Article Title: Chikungunya virus uses the tetraspanins CD63, CD9, and CD151 to replicate in human synovial fibroblasts. Article Snippet: .. Oligonucleotides Silencer negative control no. 2 siRNA Thermo Fisher Scientific Cat# AM4613 Silencer GFP siRNA Thermo Fisher Scientific Cat# AM4626 CATCTGCACCCAAGTGTACCA microsynth qPCR CHIKV fw GCGCATTTTGCCTTCGTAATG microsynth qPCR CHIKV rev 6FAM-CggTgTACACTgCCTgTgACYgC—BBQ TIB MolBiol CHIKV probe Recombinant DNA pczVSV-G Hoffmann et al.43 https://doi.org/10.1099/vir.0.023978–0 pIRES2-eGFP CHIKV E3-E1 Salvador et al.44 https://doi.org/10.1016/j.virol.2009.07.013 pChik-LR-5‘GFP Tsetsarkin et al.40 https://doi.org/10.1089/vbz.2006.6.325 pChikRepl-eGFP Gläsker et al.45 https://doi.org/10.1186/1743-422X-10–23 pcDNA3.1(+) Addgene Cat# V790-20 Software and algorithms Fiji – ImageJ https://github.com/fiji/fiji Version 2.14.0/1.54f Software:Article Title: Chikungunya virus uses the tetraspanins CD63, CD9, and CD151 to replicate in human synovial fibroblasts. Article Snippet: .. Oligonucleotides Silencer negative control no. 2 siRNA Thermo Fisher Scientific Cat# AM4613 Silencer GFP siRNA Thermo Fisher Scientific Cat# AM4626 CATCTGCACCCAAGTGTACCA microsynth qPCR CHIKV fw GCGCATTTTGCCTTCGTAATG microsynth qPCR CHIKV rev 6FAM-CggTgTACACTgCCTgTgACYgC—BBQ TIB MolBiol CHIKV probe Recombinant DNA pczVSV-G Hoffmann et al.43 https://doi.org/10.1099/vir.0.023978–0 pIRES2-eGFP CHIKV E3-E1 Salvador et al.44 https://doi.org/10.1016/j.virol.2009.07.013 pChik-LR-5‘GFP Tsetsarkin et al.40 https://doi.org/10.1089/vbz.2006.6.325 pChikRepl-eGFP Gläsker et al.45 https://doi.org/10.1186/1743-422X-10–23 pcDNA3.1(+) Addgene Cat# V790-20 Software and algorithms Fiji – ImageJ https://github.com/fiji/fiji Version 2.14.0/1.54f Imaging:Article Title: Chikungunya virus uses the tetraspanins CD63, CD9, and CD151 to replicate in human synovial fibroblasts. Article Snippet: .. Oligonucleotides Silencer negative control no. 2 siRNA Thermo Fisher Scientific Cat# AM4613 Silencer GFP siRNA Thermo Fisher Scientific Cat# AM4626 CATCTGCACCCAAGTGTACCA microsynth qPCR CHIKV fw GCGCATTTTGCCTTCGTAATG microsynth qPCR CHIKV rev 6FAM-CggTgTACACTgCCTgTgACYgC—BBQ TIB MolBiol CHIKV probe Recombinant DNA pczVSV-G Hoffmann et al.43 https://doi.org/10.1099/vir.0.023978–0 pIRES2-eGFP CHIKV E3-E1 Salvador et al.44 https://doi.org/10.1016/j.virol.2009.07.013 pChik-LR-5‘GFP Tsetsarkin et al.40 https://doi.org/10.1089/vbz.2006.6.325 pChikRepl-eGFP Gläsker et al.45 https://doi.org/10.1186/1743-422X-10–23 pcDNA3.1(+) Addgene Cat# V790-20 Software and algorithms Fiji – ImageJ https://github.com/fiji/fiji Version 2.14.0/1.54f |